CURSO DE BIOLOGÍA

Alejandro Porto Andión

Departamento de Biología-Geología - IES María Casares - Oleiros - A Coruña

 
 

IES María Casares           Inicio                    Aula virtual

 
 

Descargar pdf

 

Preguntas breves

  1.  Indica en qué datos experimentales se basaron Watson y Crick para elaborar su modelo de doble hélice para la estructura del DNA.

  2. Enuncia brevemente la “regla de equivalencia de bases” de Chargaff.

  3. ¿Por qué decimos que las dos hebras de una doble hélice de DNA son antiparalelas?

  4. La transformación R  S observada por Griffith en los pneumococos fue atribuida por algunos críticos a que algunas bacterias S habían sobrevivido a la esterilización por calor, siendo éstas las responsables de la infección y muerte del ratón y no las bacterias R supuestamente transformadas. ¿Cómo se pudo demostrar que en efecto tenía lugar una transformación R S?

  5. ¿Qué demostraron exactamente Hershey y Chase en su experimento con bacteriófagos?

  6. ¿Qué procedimiento utilizaron Avery y sus colaboradores para demostrar que el “principio transformante” era DNA?

  7.  Enumera los tres modelos “a priori” considerados para la replicación del DNA y explica brevemente en qué consiste cada uno de ellos.

  8. Explica esquemáticamente los resultados que hubiesen obtenido Messelson y Sthall en su experimento en caso de que la replicación del DNA siguiese un modelo dispersivo. ¿Y en el caso de que fuese conservativo?

  9. ¿Por qué las cadenas de DNA en crecimiento se sintetizan a partir de nucleótidos trifosfato y no a partir de nucleótidos monofosfato?

  10. Explica en pocas palabras qué es lo que Asaben” hacer las DNA polimerasas conocidas hasta la actualidad.

  11. Explica por qué en la replicación del DNA son necesarios los “cebadores”. ¿En qué consisten tales cebadores?

  12. ¿Qué hecho estamos resaltando cuando decimos que la replicación del DNA es “semiconservativa”?

  13.  Comenta las diferencias entre el concepto clásico de gen y el nuevo concepto que surge con la biología molecular.

  14. ¿Por qué decimos que la replicación del DNA es bidireccional?

  15. Explica el problema que se deriva del hecho de que las DNA polimerasas solo puedan sitentizar cadenas en dirección 5'3'.

  16. En la replicación del DNA ¿a qué llamamos hebra líder y a qué hebra rezagada? ¿En qué consisten los llamados “fragmentos de Okazaki”?

  17. ¿Cómo explicarías, a la luz de los conocimientos actuales, el fenómeno de la transformación RS observado por F. Griffith en sus experimentos con neumococos?

  18. En el lejano planeta Rebordelos (todavía por descubrir) existen organismos vivos que difieren de los organismos terrestres en algunos aspectos de su bioquímica. El profesor Bernardo Lumbreras, prestigioso investigador rebordeliano, ha realizado recientemente en su planeta un experimento análogo al realizado en la Tierra por Messelson y Sthal. Los resultados que obtuvo fueron los siguientes: en la primera generación el tubo de la centrífuga mostraba una banda “ligera” y otra “pesada”; en sucesivas generaciones se mantenía este patrón, pero la banda “ligera” se iba haciendo más nítida mientras que la “pesada” se iba difuminando; en ningún caso aparecían bandas híbridas. A la vista de estos resultados ¿podrías ayudar al profesor Lumbreras a discernir que tipo de replicación del DNA presentan los organismos vivos de Rebordelos?

  19. ¿A qué llamamos “molde” y “cebador” en el proceso de replicación del DNA?

  20. Explica de donde proviene la energía necesaria para enlazar los sucesivos restos nucleotídicos en una cadena de DNA en crecimiento.

  21. Todas las DNA-polimerasas conocidas sintetizan DNA añadiendo nucleótidos en dirección 5'3'. Por otra parte, las dos cadenas de una doble hélice de DNA son antiparalelas. Explica como pueden las células vivas sintetizar simultáneamente las dos cadenas hijas complementarias a las dos cadenas parentales de una molécula de DNA en replicación.

  22. Explica como solucionan las células eucariotas el problema del acortamiento de los telómeros que se produce en cada ciclo de división celular. ¿Por qué no se da este problema en las células procariotas?

  23. ¿Cuál es la función que realizan las helicasas y las topoisomerasas en la replicación del DNA?

  24. ¿Cuál es el papel de la DNA ligasa en la replicación del DNA?

  25. ¿Qué característica de la telomerasa le permite “reparar” los extremos de los cromosomas?

  26. Enumera los principales tipos de RNA y cita la función biológica de cada uno de ellos.

  27. Indica cuáles de las siguientes proposiciones son verdaderas y cuáles falsas atendiendo a la regla de equivalencia de bases de Chargaff:

    • [A+C] = [G+T]

    • [A] = [T] y [G] = [C]

    • [A+G] = [C+T]

    • [A] = [G] y [T] = [C]

    • [A] = [C] y [G] = [T]

  28. Señala la diferencia esencial entre las “habilidades” de las DNA polimerasas y las RNA polimerasas.

  29. En la actualidad se considera más apropiado referirse a la clásica teoría “un gen - un enzima” con la denominación “un gen - un polipéptido” o incluso “un cistrón - un polipéptido”. Trata de justificar este cambio de denominación.

  30. ¿Todas las células somáticas de un organismo pluricelular llevan la misma información genética? Justifica la respuesta.

  31.  ¿En todas las células somáticas de un organismo pluricelular se expresa la misma información genética? Justifica la respuesta.

  32. Explica en pocas palabras los conceptos de transcripción y traducción.

  33. Elabora un pequeño esquema en el que se refleje el denominado “dogma central de la biología molecular”.

  34. ¿Pueden existir segmentos con estructura de doble hélice dentro de una molécula de RNA? ¿Y dobles hélices mixtas DNA-RNA? Pon ejemplos de uno y otro caso.

  35.  Los productos de la transcripción ¿terminan siempre siendo traducidos a la estructura primaria de una proteína? Justifica la respuesta.

  36.  Enumera las tres fases de que consta el proceso de transcripción. ¿Como se llama la fase adicional que puede tener lugar o no?

  37. Explica los conceptos de exón e intrón.

  38. ¿En qué fase de la expresión génica se eliminan los intrones? ¿Tiene lugar antes o después de la transcripción?

  39. ¿En qué grupos de organismos los genes se encuentran fragmentados en intrones y exones y en cuales no lo están?

  40. ¿En qué consiste el proceso de maduración del RNA transcrito primario en las células eucariotas?

  41. ¿Por qué en los organismos eucariontes la transcripción y la traducción no pueden ser casi simultáneas como lo son en los procariontes?

  42. Enuncia al menos tres diferencias entre la transcripción en procariontes y en eucariontes.

  43. ¿Por qué decimos que el código genético es degenerado, universal, sin comas y sin solapamientos?

  44. ¿Qué ventaja evolutiva pudo suponer la “degeneración” del código genético?

  45. Con la ayuda de una tabla del código genético, si es preciso, determina la secuencia de aminoácidos codificada en la secuencia de nucleótidos del siguiente fragmento de DNA (se tendrán en cuenta los tripletes de inicio y fin de síntesis)

    • 3' GTTATTTACGATTAGCCCAAAAGGTGCACTAAAGTC 5'

  46. Define con precisión los términos codón y anticodón.

  47. ¿En dónde reside la especificidad de la unión entre cada aminoácido y su correspondiente t-RNA?

  48. En ocasiones se observan al microscopio electrónico estructuras inestables, denominadas polisomas, que están formadas por varios ribosomas próximo unos a otros. ¿Qué interpretación darías a estas estructuras?

  49. ¿Cuál es la función del enzima peptidil-transferasa en el proceso de síntesis de una proteína?

  50. ¿Cuál es el aminoácido con el que generalmente se inicia la síntesis de una cadena polipeptídica? ¿En qué extremo de la cadena se sitúa?

  51. ¿Qué representan los denominados “sitio A” y “sitio P” en el proceso de traducción?

  52. ¿Por qué la regulación de la expresión génica tiene lugar fundamentalmente a nivel del proceso de transcripción y no del de traducción?

  53.  Define los términos operón, promotor, operador, represor.

  54. Explica la diferencia entre genes estructurales y genes reguladores.

  55. Explica la diferencia entre mutación génica y mutación cromosómica.

  56. ¿En qué reside la capacidad mutagénica de los agentes químicos denominados “análogos de base”?

  57. Explica cómo actúan los denominados “agentes intercalantes” en la producción de mutaciones. ¿Qué tipo de mutación suelen producir?

  58. ¿Por qué la inserción o deleción de una base en una cadena de DNA suele tener consecuencias más drásticas que una simple sustitución de una base por otra?