CURSO DE BIOLOGÍA

Alejandro Porto Andión

Departamento de Biología-Geología - IES María Casares - Oleiros - A Coruña

 
 

IES María Casares           Inicio                    Aula virtual

 
 

 

Soluciones a preguntas breves

  1.  Indica en qué datos experimentales se basaron Watson y Crick para elaborar su modelo de doble hélice para la estructura del DNA.

    Se basaron en los difractogramas de rayos X obtenidos por Rosalind Franklin y en los datos obtenidos por E. Chargaff acerca de la composición en bases nitrogenadas del DNA de diferentes especies (regla de Chargaff)

     

  2. Enuncia brevemente la “regla de equivalencia de bases” de Chargaff.

En una molécula de DNA el número de Adeninas es igual al de Timinas y el número de Guaninas es igual al de Citosinas. De ello se deduce que el número de bases púricas es igual al de bases pirimídicas.

  1. ¿Por qué decimos que las dos hebras de una doble hélice de DNA son antiparalelas?

Porque se recorren en direcciones opuestas: si recorremos al mismo tiempo las dos cadenas de la doble hélice, en una de ellas iríamos desde el extremo 5' al 3' y en la otra desde el 3' al 5'.

  1. La transformación R  S observada por Griffith en los pneumococos fue atribuida por algunos críticos a que algunas bacterias S habían sobrevivido a la esterilización por calor, siendo éstas las responsables de la infección y muerte del ratón y no las bacterias R supuestamente transformadas. ¿Cómo se pudo demostrar que en efecto tenía lugar una transformación R S?

Avery y sus colaboradores comprobaron que la transformación R S también era inducida por extracto libre de células de las bacterias S muertas por el calor (un lisado de las células muertas que posteriormente fue filtrado para eliminar cualquier resto celular)

  1. ¿Qué demostraron exactamente Hershey y Chase en su experimento con bacteriófagos?

Demostraron que el DNA vírico era el material genético del virus, puesto que una molécula de DNA era el único nexo material entre dos generaciones sucesivas de virus.

  1. ¿Qué procedimiento utilizaron Avery y sus colaboradores para demostrar que el “principio transformante” era DNA?

Fraccionaron el extracto y fueron ensayando la capacidad transformante de los distintos tipos de biomoléculas (polisacáridos, proteínas, RNA, DNA...)

  1.  Enumera los tres modelos “a priori” considerados para la replicación del DNA y explica brevemente en qué consiste cada uno de ellos.

  • Conservativa.- La doble hélice, sin perder su integridad, sirve de molde para sintetizar una réplica idéntica.

  • Semiconservativa.- La doble hélice se desenrolla y cada una de las cadenas sirve de molde para sintetizar una cadena complementaria siguiendo las reglas del apareamiento de bases.

  • Dispersiva.- La doble hélice original se descompone en fragmentos, que son utilizados junto con otros de nueva síntesis para sintetizar dos dobles hélices idénticas.

  1. Explica esquemáticamente los resultados que hubiesen obtenido Messelson y Sthall en su experimento en caso de que la replicación del DNA siguiese un modelo dispersivo. ¿Y en el caso de que fuese conservativo?

  • Dispersivo.- En la generación 1 se habría obtenido una sola banda híbrida (igual que en el modelo conservativo) en las sucesivas generaciones esta banda híbrida se iría desplazando gradualmente hacia la posición de la banda ligera (por incorporar cada vez más nucleótidos con nitrógeno ligero).

  • Conservativo.- En la generación 1 aparecería una banda ligera y otra pesada. Este patrón se mantendría en sucesivas generaciones, pero la banda ligera se iría haciendo cada vez más nítida mientras que se iría desvaneciendo la banda pesada. No aparecerían bandas híbridas.

  1. ¿Por qué las cadenas de DNA en crecimiento se sintetizan a partir de nucleótidos trifosfato y no a partir de nucleótidos monofosfato?

Porque para que se forme el enlace éster entre el último nucleótido de la cadena en crecimiento y el nucleótido que se incorpora a ella es necesaria energía, y ésta se obtiene de la escisión de los dos grupos fosfato terminales del nucleótido trifosfato entrante.

  1. Explica en pocas palabras qué es lo que "saben” hacer las DNA polimerasas conocidas hasta la actualidad.

"Saben" añadir nucleótidos a una de las cadenas de DNA de una doble hélice utilizando como molde su cadena complementaria. Es decir, necesitan una cadena molde y una cadena de nucleótidos apareada con ella a la que añadir nucleótidos. No "saben" iniciar una cadena polinucleotídica.

  1. Explica por qué en la replicación del DNA son necesarios los “cebadores”. ¿En qué consisten tales cebadores?

Porque las DNA polimerasas no pueden iniciar cadenas polinucleotídicas. Los cebadores son cadenas de ribonucleótidos, sintetizadas por las primasas y apareadas con la cadena molde, a las que las DNA polimerasas añaden cadenas de desoxirribonucleótidos.

  1. ¿Qué hecho estamos resaltando cuando decimos que la replicación del DNA es “semiconservativa”?

Estamos poniendo de manifiesto que en la doble hélice que resulta de la replicación una de las cadenas procede de la doble hélice parental mientras que la otra es sintetizada "ex novo" en el proceso de replicación.

  1.  Comenta las diferencias entre el concepto clásico de gen y el nuevo concepto que surge con la biología molecular.

Desde el punto de vista clásico el gen es una entidad, de la que se desconoce su naturaleza, capaz de controlar un carácter hereditario, de mutar y de recombinar, mientras que el nuevo concepto de gen que surge con la biología molecular lo define como una doble cadena polinucleotídica que, en forma de secuencia de nucleótidos, contiene la información necesaria para ordenar los aminoácidos de una determinada proteína.

  1. ¿Por qué decimos que la replicación del DNA es bidireccional?

Porque parte de un origen de replicación y progresa desde este en direcciones opuestas en forma de dos horquillas de replicación que se alejan una de la otra.

  1. Explica el problema que se deriva del hecho de que las DNA polimerasas solo puedan sitentizar cadenas en dirección 5'3'.

A medida que avanza la horquilla de replicación, una de las cadenas, la llamada hebra conductora, puede ser sintetizada de manera continua, mientras que la otra, la hebra rezagada, debe ser sintetizada en forma de fragmentos cortos (fragmentos de Okazaki), dado que las DNA polimerasas tienen que sintetizarla en dirección opuesta a la del avance de la horquilla.

  1. En la replicación del DNA ¿a qué llamamos hebra líder y a qué hebra rezagada? ¿En qué consisten los llamados “fragmentos de Okazaki”?

La hebra líder es la que se sintetiza de manera continua en la misma dirección de avance de la horquilla de replicación. La hebra rezagada es la que se sintetiza en forma de fragmentos cortos (fragmentos de Okazaki) que las DNA polimerasas sintetizan en dirección opuesta a la del avance de la horquilla.

  1. ¿Cómo explicarías, a la luz de los conocimientos actuales, el fenómeno de la transformación RS observado por F. Griffith en sus experimentos con neumococos?

Fragmentos de DNA procedentes de las bacterias S, con la información necesaria para fabricar la cápsula que caracteriza a estas bacterias, penetran en las bacterias R y, por medio de un proceso de recombinación genética, sustituyen a los segmentos de DNA equivalentes en estas últimas, que resultan así transformadas.

  1. En el lejano planeta Rebordelos (todavía por descubrir) existen organismos vivos que difieren de los organismos terrestres en algunos aspectos de su bioquímica. El profesor Bernardo Lumbreras, prestigioso investigador rebordeliano, ha realizado recientemente en su planeta un experimento análogo al realizado en la Tierra por Messelson y Sthal. Los resultados que obtuvo fueron los siguientes: en la primera generación el tubo de la centrífuga mostraba una banda “ligera” y otra “pesada”; en sucesivas generaciones se mantenía este patrón, pero la banda “ligera” se iba haciendo más nítida mientras que la “pesada” se iba difuminando; en ningún caso aparecían bandas híbridas. A la vista de estos resultados ¿podrías ayudar al profesor Lumbreras a discernir que tipo de replicación del DNA presentan los organismos vivos de Rebordelos?

La replicación parece ser conservativa, dado que este es el único modelo compatible con la aparición de una banda ligera y otra pesada en la primera generación del experimento.

  1. ¿A qué llamamos “molde” y “cebador” en el proceso de replicación del DNA?

El molde es la cadena de DNA complementaria  con respecto a la que se está sintetizando. El cebador es una secuencia corta de nucleótidos de RNA, sintetizada por una primasa, que resulta necesaria para que las DNA polimerasas puedan añadir a ella nuevos nucleótidos.

  1. Explica de donde proviene la energía necesaria para enlazar los sucesivos restos nucleotídicos en una cadena de DNA en crecimiento.

De la escisión de los dos grupos fosfatos terminales del nucleótido trifosfato entrante que se incorpora a la cadena en crecimiento.

  1. Todas las DNA-polimerasas conocidas sintetizan DNA añadiendo nucleótidos en dirección 5'3'. Por otra parte, las dos cadenas de una doble hélice de DNA son antiparalelas. Explica como pueden las células vivas sintetizar simultáneamente las dos cadenas hijas complementarias a las dos cadenas parentales de una molécula de DNA en replicación.

En una de ellas, la hebra rezagada, la síntesis debe ser discontinua (en forma de fragmentos de Okazaki), que se van sintetizando por las DNA polimerasas en dirección opuesta al del avance de la horquilla de replicación.

  1. Explica como solucionan las células eucariotas el problema del acortamiento de los telómeros que se produce en cada ciclo de división celular. ¿Por qué no se da este problema en las células procariotas?

Lo solucionan por la acción de la telomerasa, un enzima que, utilizando como molde una cadena de RNA que lleva incorporada como grupo prostético, añade algunas decenas de nucleótidos sin información a la cadena que termina en el extremo 3' de manera que el equipo enzimático de la replicación puede alargar la cadena complementaria compensando así el acortamiento.

En las células eucariotas este problema no existe debido al carácter circular de los cromosomas procariotas.

  1. ¿Cuál es la función que realizan las helicasas y las topoisomerasas en la replicación del DNA?

Las helicasas hacen avanzar la horquilla de replicación desenrollando las dos cadenas de la doble hélice. Las topoisomerasas relajan la tensión producida por este desenrollamiento mediante cortes y empalmes en una de las cadenas.

  1. ¿Cuál es el papel de la DNA ligasa en la replicación del DNA?

Establecer enlaces éster entre nucleótidos adyacentes que todavía no están unidos, lo que resulta imprescindible para sellar la unión entre los fragmentos que resultan de la replicación discontinua en la hebra rezagada.

  1. ¿Qué característica de la telomerasa le permite “reparar” los extremos de los cromosomas?

El hecho de llevar incorporado como grupo prostético una secuencia de RNA que actúa como molde para alargar la cadena que termina en el extremo 3'.

  1. Enumera los principales tipos de RNA y cita la función biológica de cada uno de ellos.

  • m-RNA.- RNA mensajero. Traslada al citosol la información cifrada en el DNA en forma de una cadena de ribonucleótidos complementaria que será leída por los ribosomas para sintetizar una proteína.

  • t-RNA.- RNAs de transferencia. Se unen de manera específica a los distintos aminoácidos y los conducen al ribosoma para ser insertados en la cadena polipeptídica en crecimiento.

  • r-RNA.- RNA ribosómico. Forma parte estructural de los ribosomas y participa en la correcta fijación del m-RNA a estos orgánulos en el proceso de síntesis de proteínas.

  • n-RNA.- RNA nucleolar. Se transcribe en el nucléolo a partir del DNA. Es precursor del r-RNA y del t-RNA.

  1. Indica cuáles de las siguientes proposiciones son verdaderas y cuáles falsas atendiendo a la regla de equivalencia de bases de Chargaff:

    • [A+C] = [G+T]                   F

    • [A] = [T] y [G] = [C]          V

    • [A+G] = [C+T]                   V

    • [A] = [G] y [T] = [C]          F

    • [A] = [C] y [G] = [T]          F

     

  2. Señala la diferencia esencial entre las “habilidades” de las DNA polimerasas y las RNA polimerasas.

Las RNA polimerasas pueden iniciar la síntesis de una cadena polinucleotídica (colocar el primer nucleótido e ir añadiendo los siguientes). Las DNA polimerasas no pueden iniciar cadenas: sólo pueden añadir nuecleótidos a una cadena preexistente (cebador).

  1. En la actualidad se considera más apropiado referirse a la clásica teoría “un gen - un enzima” con la denominación “un gen - un polipéptido” o incluso “un cistrón - un polipéptido”. Trata de justificar este cambio de denominación.

En las proteínas oligoméricas (formadas por varias cadenas polipeptídicas) cada subunidad puede estar codificada por un gen diferente.

  1. ¿Todas las células somáticas de un organismo pluricelular llevan la misma información genética? Justifica la respuesta.

Sí. Todas descienden por sucesivas mitosis de una única célula (el zigoto en el caso de los organismos que se reproducen sexualmente). En la mitosis se copia fielmente toda la información de la célula madre.

  1.  ¿En todas las células somáticas de un organismo pluricelular se expresa la misma información genética? Justifica la respuesta.

No. Precisamente, el proceso de diferenciación celular que caracteriza a la pluricelularidad se basa en la expresión diferencial de los genes. La expresión de genes diferentes (o de los mismos genes expresados en distinto orden) da lugar a los distintos tipos celulares que dan lugar a los distintos tejidos.

  1. Explica en pocas palabras los conceptos de transcripción y traducción.

Transcripción.- Síntesis de una molécula de RNA utilizando como molde una cadena de DNA de la que es complementaria.

Traducción.- Síntesis por los ribosomas de una cadena polipeptídica cuya secuencia de aminoácidos está cifrada en una molécula de RNA mensajero.

  1. Elabora un pequeño esquema en el que se refleje el denominado “dogma central de la biología molecular”.

  1. ¿Pueden existir segmentos con estructura de doble hélice dentro de una molécula de RNA? ¿Y dobles hélices mixtas DNA-RNA? Pon ejemplos de uno y otro caso.

Sí pueden existir. En las moléculas de t-RNA existen horquillas y bucles como consecuencia del emparejamiento de secuencias de bases complementarias dentro de la misma cadena. Por otra parte, en el proceso de trascripción se forma transitoriamente un dúplex mixto DNA-RNA.

  1.  Los productos de la transcripción ¿terminan siempre siendo traducidos a la estructura primaria de una proteína? Justifica la respuesta.

No siempre. Las moléculas de r-RNA y t-RNA no son traducidas a una secuencia de aminoácidos, sino que cumplen funciones como tales RNA en la síntesis de otras proteínas.

  1.  Enumera las tres fases de que consta el proceso de transcripción. ¿Como se llama la fase adicional que puede tener lugar o no?

Iniciación, elongación y terminación. La fase adicional que ocurre en células con genes fragmentados es el procesamiento del trascrito primario.

  1. Explica los conceptos de exón e intrón.

Exón.- tramo de la molécula de DNA que contiene información para la secuencia de aminoácidos de una proteína.

Intrón.- tramo de la molécula de DNA, intercalado entre los exones, que no contiene información para una secuencia de aminoácidos.

  1. ¿En qué fase de la expresión génica se eliminan los intrones? ¿Tiene lugar antes o después de la transcripción?

Se eliminan durante el procesamiento del RNA transcrito primario. Tiene lugar después de la transcripción.

  1. ¿En qué grupos de organismos los genes se encuentran fragmentados en intrones y exones y en cuales no lo están?

Se encuentran fragmentados en todos los eucariontes y en las arqueobacterias y no fragmentados en las eubacterias.

  1. ¿En qué consiste el proceso de maduración del RNA transcrito primario en las células eucariotas?

  • Adición de la caperuza en el extremo 5'.

  • Adición de la cola de poliA en el extremo 3'.

  • Eliminación de intrones por corte y empalme.

  1. ¿Por qué en los organismos eucariontes la transcripción y la traducción no pueden ser casi simultáneas como lo son en los procariontes?

Porque la transcripción ocurre en el núcleo, donde se encuentra el DNA, mientras que la síntesis de proteínas (traducción) ocurre en el citosol, donde se encuentran los ribosomas. Ambos compartimentos están físicamente separados por la envoltura nuclear, por lo que el m-RNA producto de la transcripción debe ser trasladado al citosol a través de dicha envoltura antes de ser traducido.

  1. Enuncia al menos tres diferencias entre la transcripción en procariontes y en eucariontes.

  • En las células procariotas el producto de la transcripción es utilizado directamente como m-RNA, mientras que en las eucariotas este transcrito primario sufre un procesamiento que lo convierte en m-RNA.

  • Los mensajeros procariotas son policistrónicos (contienen la información para la síntesis de varias cadenas polipeptídicas) mientras que en las células eucariotas son monocistrónicos (un gen-una molécula de m-RNA)

  • En las células procariotas la transcripción y la traducción son simultáneas mientras que en en las eucariotas ocurren en momentos y lugares diferentes.

  1. ¿Por qué decimos que el código genético es degenerado, universal, sin comas y sin solapamientos?

  • Degenerado.- porque contiene tripletes sinónimos (tripletes diferentes que codifican el mismo aminoácido)

  • Universal.- porque es el mismo en todas las formas de vida.

  • Sin comas.- porque no presenta símbolos de separación de palabras (se lee de corrido desde el triplete de inicio hasta el de fin de síntesis)

  • Sin solapamientos.- Porque cada triplete participa en la codificación de un único aminoácido.

  1. ¿Qué ventaja evolutiva pudo suponer la “degeneración” del código genético?

La existencia de tripletes sinónimos convierte en "silenciosas" a una buena proporción de las mutaciones que sufre el DNA (sustituciones de bases nitrogenadas que no suponen sustituciones de aminoácidos).

  1. Con la ayuda de una tabla del código genético, si es preciso, determina la secuencia de aminoácidos codificada en la secuencia de nucleótidos del siguiente fragmento de DNA (se tendrán en cuenta los tripletes de inicio y fin de síntesis)

    • 3' GTTATTTACGATTAGCCCAAAAGGTGCACTAAAGTC 5'

    (m-RNA): 5' CAAUAAAUGCUAAUCGGGUUUUCCACGUGAUUUCAG 3'

    Proteína: Met-Leu-Ile-Gly-Phe-Ser-Thr-FIN

     

  2. Define con precisión los términos codón y anticodón.

  • Codón.- Triplete de bases del m-RNA que codifica un aminoácido dado.

  • Anticodón.- Triplete de bases del t-RNA complementario con el correspondiente codón del m-RNA.

  1. ¿En dónde reside la especificidad de la unión entre cada aminoácido y su correspondiente t-RNA?

En la conformación tridimensional de los enzimas aminoacil-t-RNA sintetasas, que reconocen a ambas moléculas y las unen de manera específica.

  1. En ocasiones se observan al microscopio electrónico estructuras inestables, denominadas polisomas, que están formadas por varios ribosomas próximo unos a otros. ¿Qué interpretación darías a estas estructuras?

Se trata de grupos de ribosomas que están unidos por una única molécula de m-RNA que está siendo traducida por ellos.

  1. ¿Cuál es la función del enzima peptidil-transferasa en el proceso de síntesis de una proteína?

Unir cada aminoácido entrante, mediante un enlace peptídico, a la cadena polipeptídica en crecimiento.

  1. ¿Cuál es el aminoácido con el que generalmente se inicia la síntesis de una cadena polipeptídica? ¿En qué extremo de la cadena se sitúa?

Metionina o formil-metionina. Se sitúa en el extremo amino-terminal.

  1. ¿Qué representan los denominados “sitio A” y “sitio P” en el proceso de traducción?

El sitio A (aminoacil) es el lugar de entrada de un nuevo aminoácido activado. El sito P (peptidil) es el lugar en el que se encuentra la cadena polipeptídica en crecimiento unida al último t-RNA entrante.

  1. ¿Por qué la regulación de la expresión génica tiene lugar fundamentalmente a nivel del proceso de transcripción y no del de traducción?

Resulta más acorde con el principio de economía molecular bloquear el proceso en el primer paso cuando éste no es necesario. Sería un desperdicio de energía sintetizar un  m-RNA que luego no va a ser traducido.

  1.  Define los términos operón, promotor, operador, represor.

  • Operón.- Unidad de regulación en células procariotas, formada por los genes estructurales, junto con sus secuencias reguladoras, y su correspondiente gen regulador.

  • Promotor.- Secuencia de DNA a la que se une la RNA polimerasa para iniciar la transcripción.

  • Operador.- Secuencia de DNA, situada entre el promotor y los genes estructurales, con la que puede interactuar la proteína represora bloqueando la transcripción.

  • Represor.-  Proteína codificada por el gen regulador, que puede interactuar con el operador para bloquear la transcripción de los genes estructurales.

 

  1. Explica la diferencia entre genes estructurales y genes reguladores.

  • Genes estructurales.- Genes cuya expresión es objeto de regulación en un operón.

  • Genes reguladores.- Genes que codifican la proteína represora que puede bloquear o desbloquear la transcripción de un conjunto de genes estructurales en un operón.

  1. Explica la diferencia entre mutación génica y mutación cromosómica.

  • Mutación génica.- mutación que afecta a un solo gen (frecuentemente supone la sustitución de un único par de bases en el DNA)

  • Mutación cromosómica.- mutación que afecta a un segmento grande de un cromosoma, que abarca muchos genes, o incluso a un cromosoma entero o a número total de cromosomas.

  1. ¿En qué reside la capacidad mutagénica de los agentes químicos denominados “análogos de base”?

En su parecido estructural con las bases nitrogenadas habituales del DNA, a las que pueden eventualmente sustituir en el proceso de replicación.

  1. Explica cómo actúan los denominados “agentes intercalantes” en la producción de mutaciones. ¿Qué tipo de mutación suelen producir?

Colocándose entre pares adyacentes de base nitrogenadas del DNA ocasiona la inserción de una base nitrogenada adicional en la cadena en replicación. Producen mutaciones de corrimiento de pauta de lectura.

  1. ¿Por qué la inserción o deleción de una base en una cadena de DNA suele tener consecuencias más drásticas que una simple sustitución de una base por otra?

Porque tal inserción o deleción supone un corrimiento de la pauta de lectura del m-RNA por los ribosomas, ocasionando que todos los aminoácidos que se incorporen a la cadena polipeptídica  después de la lectura del codón que lleva la inserción o deleción estén mal codificados.